CAMK2G (1 of 2)

Ensembl ID:
ENSDARG00000056206
Description:
calcium/calmodulin-dependent protein kinase II gamma [Source:HGNC Symbol;Acc:1463]
Human Orthologue:
CAMK2G
Human Description:
calcium/calmodulin-dependent protein kinase II gamma [Source:HGNC Symbol;Acc:1463]
Mouse Orthologue:
Camk2g
Mouse Description:
calcium/calmodulin-dependent protein kinase II gamma Gene [Source:MGI Symbol;Acc:MGI:88259]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15148 Essential Splice Site Available for shipment Available now
sa12015 Nonsense Available for shipment Available now
sa35467 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078652 Essential Splice Site 153 598 6 23
Genomic Location (Zv9):
Chromosome 13 (position 22339579)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22068917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGAGAAAGGACCCTTATGGCAAGCCAGTTGATATCTGGGCCTGTGG[T/G]AAGGTTATAAAATATTACAGTGTTTCCATGAATGGTGTCTTTGTTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078652 Nonsense 242 598 9 23
Genomic Location (Zv9):
Chromosome 13 (position 22347197)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22076535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGCYCCACCGTCGCCTCCATGATGCAWYGTCAAGAAACCGTTGAGTG[T/A]CTGCGCAAGTTCAACGCYCGCAGAAAACTGAAGGTCTGATTCATTCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078652 Nonsense 373 598 16 23
Genomic Location (Zv9):
Chromosome 13 (position 22363763)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22093101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTCTCTCTCTCTGTCTCTCTCCTCACAGGGATCTACAGAGAGCTG[T/A]AACACCACAGAAGAGGAGGACATGAAAGGTAGGAAAGGTACAATATCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link