CAMK2G (1 of 2)

Ensembl ID:
ENSDARG00000056206
Description:
calcium/calmodulin-dependent protein kinase II gamma [Source:HGNC Symbol;Acc:1463]
Human Orthologue:
CAMK2G
Human Description:
calcium/calmodulin-dependent protein kinase II gamma [Source:HGNC Symbol;Acc:1463]
Mouse Orthologue:
Camk2g
Mouse Description:
calcium/calmodulin-dependent protein kinase II gamma Gene [Source:MGI Symbol;Acc:MGI:88259]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15148 Essential Splice Site Available for shipment Available now
sa12015 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078652 Essential Splice Site 153 598 6 23
Genomic Location:
Chromosome 13 (position 22339579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGAGAAAGGACCCTTATGGCAAGCCAGTTGATATCTGGGCCTGTGG[T/G]AAGGTTATAAAATATTACAGTGTTTCCATGAATGGTGTCTTTGTTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078652 Nonsense 242 598 9 23
Genomic Location:
Chromosome 13 (position 22347197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGCYCCACCGTCGCCTCCATGATGCAWYGTCAAGAAACCGTTGAGTG[T/A]CTGCGCAAGTTCAACGCYCGCAGAAAACTGAAGGTCTGATTCATTCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gqgmawmp