abcb9

Ensembl ID:
ENSDARG00000056200
ZFIN ID:
ZDB-GENE-050517-12
Description:
ATP-binding cassette sub-family B member 9 [Source:RefSeq peptide;Acc:NP_001119906]
Human Orthologue:
ABCB9
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 9 [Source:HGNC Symbol;Acc:50]
Mouse Orthologue:
Abcb9
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1861729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20431 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078649 Essential Splice Site 687 789 10 11
Genomic Location:
Chromosome 5 (position 29663563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTGGATGAAGCCACAAGCGCACTGGATTCAGAAAGCGAATACATAG[T/C]AAGCAACGGCTATTACATTTGAAGACTGGCTCTAGTAAACATTTCAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yqf5rfz3