
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcb9
- Ensembl ID:
- ENSDARG00000056200
- ZFIN ID:
- ZDB-GENE-050517-12
- Description:
- ATP-binding cassette sub-family B member 9 [Source:RefSeq peptide;Acc:NP_001119906]
- Human Orthologue:
- ABCB9
- Human Description:
- ATP-binding cassette, sub-family B (MDR/TAP), member 9 [Source:HGNC Symbol;Acc:50]
- Mouse Orthologue:
- Abcb9
- Mouse Description:
- ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1861729]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20431 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20431
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078649 | Essential Splice Site | 687 | 789 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 5 (position 29663563)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 27418861 GRCz11 5 28019014 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTCTGGATGAAGCCACAAGCGCACTGGATTCAGAAAGCGAATACATAG[T/C]AAGCAACGGCTATTACATTTGAAGACTGGCTCTAGTAAACATTTCAGTGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: