nme7

Ensembl ID:
ENSDARG00000056193
ZFIN ID:
ZDB-GENE-000210-35
Description:
nucleoside diphosphate kinase 7 [Source:RefSeq peptide;Acc:NP_571004]
Human Orthologue:
NME7
Human Description:
non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Nme7
Mouse Description:
non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33879 Essential Splice Site Available for shipment Available now
sa40707 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078630 Essential Splice Site 128 374 4 12
Genomic Location (Zv9):
Chromosome 6 (position 28992627)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29288270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGCCAACCTAATCGTCACCAAAGCCAAAATGACTAAACTTACATGG[T/A]AGGTTTTGCTTAATGATAGCAATGTTGGCAGCAGCCCCTCCGCAAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078630 Nonsense 340 374 11 12
Genomic Location (Zv9):
Chromosome 6 (position 28945099)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29240742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGTTTCCACACAGGAAATTGCACGCCACCTTCGGCCCAAAACTTTA[C/T]GAGCCCTGTACGGCAAAAACAAACTGCAGAACGGCGTTCACTGCACAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link