si:ch211-168k14.2

Ensembl ID:
ENSDARG00000056191
ZFIN ID:
ZDB-GENE-070912-149
Description:
Novel protein similar to vertebrate phospholipase D1, phosphatidylcholine-specific (PLD1) [Source:Un
Human Orthologues:
PLD1, PLD2
Human Descriptions:
phospholipase D1, phosphatidylcholine-specific [Source:HGNC Symbol;Acc:9067]
phospholipase D2 [Source:HGNC Symbol;Acc:9068]
Mouse Orthologues:
Pld1, Pld2
Mouse Descriptions:
phospholipase D1 Gene [Source:MGI Symbol;Acc:MGI:109585]
phospholipase D2 Gene [Source:MGI Symbol;Acc:MGI:892877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6115 Nonsense Confirmed mutation in F2 line During 2014
sa21513 Nonsense Mutation detected in F1 DNA During 2014
sa7193 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6115
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Nonsense 120 984 3 32
ENSDART00000133094 Nonsense 126 452 4 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 32574678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACGGAGAACGCATCCCAACATTACCAAGAAGACCTGATGCCCTCGTC[A/T]GAGAGGAACAGCTCATCAGCAGAAAAGTGACTTTTTTTTNNATTTTAATT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
skeletal muscle
ZFA:0005277
quality
PATO:0000001
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
20:34819253-34819800 34819253 -1 9.38 × 10-25 1.2 -3 stmn4 ENSDARG00000030106
1:54519801-54520283 54520283 1 6.01 × 10-20 -0.7 -3 acta1a ENSDARG00000036371
16:11943301-11944551 11944551 1 1.10 × 10-19 -0.3 41 tubb5 ENSDARG00000037997
17:12571801-12572116 12572116 1 1.93 × 10-18 1.9 -2 stmn4l ENSDARG00000043932
3:15313019-15313400 15313019 -1 7.83 × 10-17 0.8 -1 mvp ENSDARG00000021242

Mutation Details

Allele Name:
sa21513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Nonsense 440 984 12 32
ENSDART00000133094 Nonsense 444 452 13 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 32582846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGCCTTCCTGGGAGGGATTGATTTGGCTTACGGAAGATGGGACGACTA[C/A]CAACACAGACTGGCTGATGTGGGAAGTGTGAGAAGAAGCCCTCAGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Essential Splice Site 578 984 None 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 Essential Splice Site 43 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 32589478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACTTCATCCTCAAAGACTGGGTCAAACTCAACAAGCCTTTTGATGG[T/C]ATGTCTACAAAATCACAACCAACAACCTCAGCATCTTCTTTTTAGACCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/85bgq346