eif5a2

Ensembl ID:
ENSDARG00000056186
ZFIN ID:
ZDB-GENE-040426-2405
Description:
eukaryotic translation initiation factor 5A-2 [Source:RefSeq peptide;Acc:NP_998427]
Human Orthologue:
EIF5A2
Human Description:
eukaryotic translation initiation factor 5A2 [Source:HGNC Symbol;Acc:3301]
Mouse Orthologue:
Eif5a2
Mouse Description:
eukaryotic translation initiation factor 5A2 Gene [Source:MGI Symbol;Acc:MGI:1933735]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19765 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078634 Essential Splice Site 135 155 4 5
ENSDART00000134077 Essential Splice Site 135 155 4 5
ENSDART00000139927 None None 128 None 4
ENSDART00000140804 Essential Splice Site 135 155 4 5
Genomic Location:
Chromosome 2 (position 25989278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGCAAAGAAATAGAGAGCAAATTTGAATCTGGAGATGAATTTCTGG[T/C]TTGTAACTTTGCTTTCAGATTTATGTCTAACCTGAGCTAATTTTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0eyxwyfb