dvl2

Ensembl ID:
ENSDARG00000056184
ZFIN ID:
ZDB-GENE-041118-20
Description:
segment polarity protein dishevelled homolog DVL-2 [Source:RefSeq peptide;Acc:NP_997813]
Human Orthologue:
DVL2
Human Description:
dishevelled, dsh homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3086]
Mouse Orthologue:
Dvl2
Mouse Description:
dishevelled 2, dsh homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106613]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40866 Nonsense Mutation detected in F1 DNA During 2017
sa20904 Essential Splice Site Available for shipment Available now
sa6076 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012450 Nonsense 232 747 6 15
ENSDART00000135316 Nonsense 179 694 5 14
Genomic Location (Zv9):
Chromosome 7 (position 21438602)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20029038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATCTAGATTGCTCAAACGCCACCGAAGACGCCGGAAACAGCGGCCA[C/T]GACTGGAGAGGGTGAGATACACCTATGTGATTAACAAATGTCAAGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012450 Essential Splice Site 498 747 13 15
ENSDART00000135316 Essential Splice Site 445 694 12 14
Genomic Location (Zv9):
Chromosome 7 (position 21446109)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20036545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAACAGTGCTACTACATATTTGGAGACTTCAGCAACTGTGAAAACTG[T/A]ACGTAGAATCAGCTTATCTGACAGTAATATCAATGAGCAGTAATTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012450 Nonsense 730 747 15 15
ENSDART00000135316 Nonsense 677 694 14 14
Genomic Location (Zv9):
Chromosome 7 (position 21450724)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20041160
KASP Assay ID:
554-3950.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGACCCGAGACCTGGGCTCCGTCCCGCCTGAGCTGACTGCTTCCAGG[C/T]AGTCCTTCCACCTGGCCATGGGCAACCCCAGTGAGTTTTTTGTGGATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link