ncam1a

Ensembl ID:
ENSDARG00000056181
ZFIN ID:
ZDB-GENE-990415-31
Description:
neural cell adhesion molecule 1 [Source:RefSeq peptide;Acc:NP_571277]
Human Orthologue:
NCAM1
Human Description:
neural cell adhesion molecule 1 [Source:HGNC Symbol;Acc:7656]
Mouse Orthologue:
Ncam1
Mouse Description:
neural cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97281]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1470 Nonsense Available for shipment Available now
sa23936 Essential Splice Site Available for shipment Available now
sa17923 Nonsense Available for shipment Available now
sa37307 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017229 Nonsense 124 837 4 18
ENSDART00000101117 Nonsense 113 288 4 7

The following transcripts of ENSDARG00000056181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 22750981)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 23436655
KASP Assay ID:
554-1395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAATGTCTTTTTCAGAGAAACTCACTTTTCAATATGCTCCATCGCCT[C/T]AAGAGTTCAACGAGGGTGATGATGCTGACATCATCTGTGATGTCATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017229 Essential Splice Site 300 837 7 18
ENSDART00000101117   None 288 None 7

The following transcripts of ENSDARG00000056181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 22744717)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 23430391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAAGGCTGGAGAGAGGAGTGAAGAAGTCACGCTCAATGTGTTTGG[T/C]AAGCTAAAGAAAAGCTATGTCACATGTTACATGGGCCACCAAATAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017229 Nonsense 301 837 8 18
ENSDART00000101117   None 288 None 7

The following transcripts of ENSDARG00000056181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 22741933)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 23427607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTGGTGTGTGTTTWAAGTGTYGTGTTTTTCTGCGAACCAACAGTG[C/T]AACCTAAGATCACCTTCCTAGAAAACCAGACGGCATCTGAGTTGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017229 Nonsense 527 837 12 18
ENSDART00000101117   None 288 None 7

The following transcripts of ENSDARG00000056181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 22693628)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 23379302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGTTTGAGGAGCCTGCTTCCAGTGGAGGAGTGCCTGTTCTGAAGTA[C/A]AAAGCTGAATGGAGGATAGCAGGCCAAGACTGGACTGACCGAGAGTATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link