hspd1

Ensembl ID:
ENSDARG00000056160
ZFIN ID:
ZDB-GENE-021206-1
Description:
60 kDa heat shock protein, mitochondrial [Source:RefSeq peptide;Acc:NP_851847]
Human Orthologue:
HSPD1
Human Description:
heat shock 60kDa protein 1 (chaperonin) [Source:HGNC Symbol;Acc:5261]
Mouse Orthologue:
Hspd1
Mouse Description:
heat shock protein 1 (chaperonin) Gene [Source:MGI Symbol;Acc:MGI:96242]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11157 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078596 None None 575 None 11
ENSDART00000127938 Essential Splice Site None 575 1 11
Genomic Location:
Chromosome 9 (position 33333841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAATTGAAATCAGTGAGCTCAAACAGGCAGGSACGTATCGTAGCATG[T/A]AAGTTAATCATGTAACACACTGTCACGTTGTTTCTCAGAGTTAKAAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9wh4cpdr