LOC556607

Ensembl ID:
ENSDARG00000056156
Human Orthologue:
NPDC1
Human Description:
neural proliferation, differentiation and control, 1 [Source:HGNC Symbol;Acc:7899]
Mouse Orthologue:
Npdc1
Mouse Description:
neural proliferation, differentiation and control gene 1 Gene [Source:MGI Symbol;Acc:MGI:1099802]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20439 Nonsense Mutation detected in F1 DNA During 2016
sa17823 Nonsense Available for shipment Available now
sa30860 Nonsense Mutation detected in F1 DNA During 2016
sa40447 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 76 281 2 8
Genomic Location (Zv9):
Chromosome 5 (position 30516524)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28278313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACTGTCCTCCATCATCAGCAAACACAGAGAATCTGAGATGAAGCACT[C/A]AGGTAAAACATGCAGATTCCACCACTGAAGAAAATAAATCCACATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 253 281 7 8
Genomic Location (Zv9):
Chromosome 5 (position 30512363)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28274152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAGCCACTTCAGATGAGGAGAATGAAGATGGAGACTTCACYGTGTA[T/G]GAATGCCCTGGACTTGCCCCAGTAAGAGCAATTCTTCATTATRCAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 257 281 7 8
ENSDART00000078592 Nonsense 257 281 7 8
Genomic Location (Zv9):
Chromosome 5 (position 30512353)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28274142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGATGAGGAGAATGAAGATGGAGACTTCACTGTGTATGAATGCCCT[G/T]GACTTGCCCCAGTAAGAGCAATTCTTCATTATGCAAAGGCTCTGTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 257 281 7 8
ENSDART00000078592 Nonsense 257 281 7 8
Genomic Location (Zv9):
Chromosome 5 (position 30512353)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28274142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGATGAGGAGAATGAAGATGGAGACTTCACTGTGTATGAATGCCCT[G/T]GACTTGCCCCAGTAAGAGCAATTCTTCATTATGCAAAGGCTCTGTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link