LOC556607

Ensembl ID:
ENSDARG00000056156
Human Orthologue:
NPDC1
Human Description:
neural proliferation, differentiation and control, 1 [Source:HGNC Symbol;Acc:7899]
Mouse Orthologue:
Npdc1
Mouse Description:
neural proliferation, differentiation and control gene 1 Gene [Source:MGI Symbol;Acc:MGI:1099802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20439 Nonsense Mutation detected in F1 DNA During 2014
sa17823 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 76 281 2 8
Genomic Location:
Chromosome 5 (position 30516524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACTGTCCTCCATCATCAGCAAACACAGAGAATCTGAGATGAAGCACT[C/A]AGGTAAAACATGCAGATTCCACCACTGAAGAAAATAAATCCACATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078592 Nonsense 253 281 7 8
Genomic Location:
Chromosome 5 (position 30512363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAGCCACTTCAGATGAGGAGAATGAAGATGGAGACTTCACYGTGTA[T/G]GAATGCCCTGGACTTGCCCCAGTAAGAGCAATTCTTCATTATRCAAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6big9mbp