si:ch211-229c8.4

Ensembl ID:
ENSDARG00000056154
ZFIN ID:
ZDB-GENE-050419-129
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQM1]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14126 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099130 Nonsense 552 843 7 8
ENSDART00000137856 Nonsense 389 688 3 4
Genomic Location (Zv9):
Chromosome 18 (position 31479879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33276738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCTGCTGCTTTGACTKTATATCATGTGCTGAAGGAGAGATCAGTAAT[C/T]AGACAGGTGTGAATTTCTTCCCTNNTTGTCACTTAATTACATTTTTTTNNNAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link