coq10b

Ensembl ID:
ENSDARG00000056141
ZFIN ID:
ZDB-GENE-050417-263
Description:
Coenzyme Q-binding protein COQ10 homolog B, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q567E6]
Human Orthologue:
COQ10B
Human Description:
coenzyme Q10 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:25819]
Mouse Orthologue:
Coq10b
Mouse Description:
coenzyme Q10 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915126]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34679 Nonsense Mutation detected in F1 DNA During 2017
sa41456 Nonsense Mutation detected in F1 DNA During 2017
sa34680 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078576 Nonsense 8 238 1 5

The following transcripts of ENSDARG00000056141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33211945)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32367891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGCGAAAGAGAGGTGAAGTGAAGATGGCGAGAGGCTCCCGGTGTT[T/A]GAGGAGAGCGGTAGCGGAGTGTATCAGAAACTTACCGTCCACAGCCGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078576 Nonsense 35 238 2 5

The following transcripts of ENSDARG00000056141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33215119)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32371065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGCTGTGTCTGAATGACAGACTTTCACCCTGTTTTGTCAACAGATA[T/A]CTGTCTTCATGTGGGATCTTGATGACCAGGGCGCCGCCCCTCTTCAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078576 Nonsense 99 238 3 5

The following transcripts of ENSDARG00000056141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33217365)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32373311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACACGCAGGTACTCAATGCAGGAAATGTATGAGGTTGTGGCCAAAGTT[G/T]AAGACTACCTGCTATTCGTGCCCTGGTGTAAGAAATCAGATGTTATTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link