sf3b1

Ensembl ID:
ENSDARG00000056138
ZFIN ID:
ZDB-GENE-040827-3
Description:
Splicing factor 3b subunit 1, 155kDa [Source:UniProtKB/TrEMBL;Acc:Q6DRD6]
Human Orthologue:
SF3B1
Human Description:
splicing factor 3b, subunit 1, 155kDa [Source:HGNC Symbol;Acc:10768]
Mouse Orthologue:
Sf3b1
Mouse Description:
splicing factor 3b, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1932339]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27426 Nonsense Mutation detected in F1 DNA During 2017
sa21516 Nonsense Available for shipment Available now
sa31725 Nonsense Available for shipment Available now
sa5549 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa27426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078568 Nonsense 423 1291 9 25
ENSDART00000129140 Nonsense 423 1315 9 25

The following transcripts of ENSDARG00000056138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33203814)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32359760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGTCCATTGACTGATGAGGAACTTGATGCAATGTTTCCAGAGGGATA[C/A]AAAGTATGTGTTATAAAAGTATCATATTATGAAAATCTACAGAGCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078568 Nonsense 466 1291 10 25
ENSDART00000129140 Nonsense 466 1315 10 25

The following transcripts of ENSDARG00000056138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33203582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32359528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGGCATGACTGGCTTCCATATGCAAACAGAAGACCGATCGATGAAA[C/T]AAGTTAACGACCAGCCATCCGGAAACCTGCCCTTCCTCAAGCCAGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078568 Nonsense 997 1291 20 25
ENSDART00000129140 Nonsense 997 1315 20 25

The following transcripts of ENSDARG00000056138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33201039)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32356985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATGGGCCATTTGGGTGTGGTGTTGTATGAGTACCTGGGAGAAGAATA[T/A]CCTGAAGTGCTGGGTAGCATTCTTGGAGCCCTGAAAGCCATCGTCAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5549
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078568 Essential Splice Site 1016 1291 21 25
ENSDART00000129140 Essential Splice Site 1016 1315 21 25

The following transcripts of ENSDARG00000056138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33199708)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32355654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGTGTTTAAGGGAAACCAGGGTTTAAATGTTTAAATGTCCTGTTTGC[A/T]GGTATGCACAAGATGACGCCTCCTATCAAAGACTTGCTTCCACGTTTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link