kitb

Ensembl ID:
ENSDARG00000056133
ZFIN ID:
ZDB-GENE-050916-2
Description:
kit receptor b [Source:RefSeq peptide;Acc:NP_001137390]
Human Orthologue:
KIT
Human Description:
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:6342]
Mouse Orthologue:
Kit
Mouse Description:
kit oncogene Gene [Source:MGI Symbol;Acc:MGI:96677]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15348 Nonsense Available for shipment Available now
sa9136 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Nonsense 197 957 3 21
ENSDART00000103093 None None 279 3 21
ENSDART00000123777 Nonsense 197 936 3 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18239168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNATCTGYGCCGGACAACTGGATCAAAAACCTGTCAAATCCAGAGAGTA[T/A]AACTTGGTTGTGCGGCTAGGTGAGTGAGTRGTARAGCAGTGGCTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Essential Splice Site 204 957 None 21
ENSDART00000103093 Essential Splice Site None 279 None 21
ENSDART00000123777 Essential Splice Site 204 936 None 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18239147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCAAAAACCTGTCAAATCCAGAGAGTATAACTTGGTTGTGCGGCTAGG[T/C]GAGTGAGTRGTARAGCAGTGGCNNNNNNNNNNATAGTTCACCAAGAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rim4d5kw