fastkd1

Ensembl ID:
ENSDARG00000056128
ZFIN ID:
ZDB-GENE-040426-1833
Description:
FAST kinase domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_991192]
Human Orthologue:
FASTKD1
Human Description:
FAST kinase domains 1 [Source:HGNC Symbol;Acc:26150]
Mouse Orthologue:
Fastkd1
Mouse Description:
FAST kinase domains 1 Gene [Source:MGI Symbol;Acc:MGI:2444596]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3724 Nonsense Mutation detected in F1 DNA During 2014
sa11929 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040229 Nonsense 108 273 2 11
ENSDART00000078556 Nonsense 108 833 1 14
ENSDART00000141405 Nonsense 108 833 2 15
Genomic Location:
Chromosome 9 (position 49227545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAACAAGATCAGCYTCATGGAGGACTGCGCTCTGGTGGACACGCTTTA[T/A]AACGTGCTCAGGTACATTAAGAAAAACCTCTGCTAGTAAACCAGTAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040229 None None 273 None 11
ENSDART00000078556 Essential Splice Site 717 833 11 14
ENSDART00000141405 Essential Splice Site 717 833 12 15
Genomic Location:
Chromosome 9 (position 49248639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAACTGTGCCAAAGCAGCAGTGGTGACTCCGTAYTACTATACTGTCGG[T/A]GAGTTACATGYRCACTACCTGACAAGGCATATCCAAGWTTTGGGAGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i0t05dmb