gdi1

Ensembl ID:
ENSDARG00000056122
ZFIN ID:
ZDB-GENE-050522-504
Description:
rab GDP dissociation inhibitor alpha [Source:RefSeq peptide;Acc:NP_001018444]
Human Orthologue:
GDI1
Human Description:
GDP dissociation inhibitor 1 [Source:HGNC Symbol;Acc:4226]
Mouse Orthologue:
Gdi1
Mouse Description:
guanosine diphosphate (GDP) dissociation inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:99846]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24345 Nonsense Available for shipment Available now
sa24344 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063388 Nonsense 86 447 4 12
ENSDART00000126299 Nonsense 86 447 4 11
Genomic Location (Zv9):
Chromosome 23 (position 26361713)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26147833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTTAATTTTCATAATATTTTTTTGTCATTGTTATCTCCCTTAAGGT[C/T]AGTTAGTTAAGATGCTTCTATACACTGAAGTGACCCGATATCTCGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063388 Nonsense 245 447 7 12
ENSDART00000126299 Nonsense 245 447 7 11
Genomic Location (Zv9):
Chromosome 23 (position 26356519)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26142639
KASP Assay ID:
2261-7826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGTGTGAGTTACAATATGGTATATTCCAACAGGTTAAGTGCAATTTA[T/A]GGAGGAACCTACATGCTGAATAAACCAGTGGATGAGATCGTGATGGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link