serac1

Ensembl ID:
ENSDARG00000056121
ZFIN ID:
ZDB-GENE-040616-1
Description:
Protein SERAC1 [Source:UniProtKB/Swiss-Prot;Acc:Q5SNQ7]
Human Orthologue:
SERAC1
Human Description:
serine active site containing 1 [Source:HGNC Symbol;Acc:21061]
Mouse Orthologue:
Serac1
Mouse Description:
serine active site containing 1 Gene [Source:MGI Symbol;Acc:MGI:2447813]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43445 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063189 Essential Splice Site 43 586 2 15
ENSDART00000063197 Essential Splice Site 43 658 2 16
Genomic Location (Zv9):
Chromosome 20 (position 26088199)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26159502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGTATAGGAAGAATAGCAAAAGTGACTGGAGCTATAGTATTTGGG[T/C]AGGTGTGTTGTTTTCTGTTTTTTGCATGCATGTTGACAAGCCATCAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link