pikfyve

Ensembl ID:
ENSDARG00000056112
ZFIN ID:
ZDB-GENE-030131-9636
Description:
1-phosphatidylinositol-3-phosphate 5-kinase [Source:RefSeq peptide;Acc:NP_001120777]
Human Orthologue:
PIKFYVE
Human Description:
phosphoinositide kinase, FYVE finger containing [Source:HGNC Symbol;Acc:23785]
Mouse Orthologue:
Pikfyve
Mouse Description:
phosphoinositide kinase, FYVE finger containing Gene [Source:MGI Symbol;Acc:MGI:1335106]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21515 Nonsense Available for shipment Available now
sa15086 Essential Splice Site Available for shipment Available now
sa41455 Nonsense Mutation detected in F1 DNA During 2017
sa12649 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078540 Nonsense 366 2084 9 41
ENSDART00000110204 Nonsense 373 2091 9 41
ENSDART00000112453 Nonsense 382 2100 10 42
ENSDART00000123278 Nonsense 242 1922 6 37

The following transcripts of ENSDARG00000056112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33118892)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32274838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTGTAATGTATAATAGCTGATTATTTTGCAGGATTCTTTTCAACTT[A/T]AAGATATATGGAAGAAGATTTGCCACAACACTACTGGGATGGAGTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078540 Essential Splice Site 680 2084 15 41
ENSDART00000110204 Essential Splice Site 687 2091 15 41
ENSDART00000112453 Essential Splice Site 696 2100 16 42
ENSDART00000123278 Essential Splice Site 556 1922 12 37

The following transcripts of ENSDARG00000056112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33123890)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32279836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTGTGACGATGATATGGACATCCGTCAGTTTGTCCACWTCAAGAAG[G/A]TAAAGACAGCAATGGAAGNAAAACTGATGAATYGAGTTTAGTAGAMACAN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078540 Nonsense 1406 2084 24 41
ENSDART00000110204 Nonsense 1413 2091 24 41
ENSDART00000112453 Nonsense 1422 2100 25 42
ENSDART00000123278 Nonsense 1282 1922 21 37

The following transcripts of ENSDARG00000056112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33128951)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32284897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGTCGGGCTAACGCTGAGCCTTGTGGCCACTCTATCCATAAAGATTA[T/A]CACCAGTACTTCTCTTACAACCAGATGGTGGCATCCTTCAGGTCTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078540 Nonsense 1940 2084 39 41
ENSDART00000110204 Nonsense 1947 2091 39 41
ENSDART00000112453 Nonsense 1956 2100 40 42
ENSDART00000123278 Nonsense 1778 1922 35 37

The following transcripts of ENSDARG00000056112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33136559)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32292505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTRTATGCYTAYAATKTTATCTGGTGTTTGTGCAGGTGTTTGACCTGAAA[G/T]GATCGCTGAGAAACAGGAACGTGAAGACGGACCAGGGAAAGGAGAGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link