lmod1

Ensembl ID:
ENSDARG00000056111
ZFIN ID:
ZDB-GENE-081104-348
Description:
Novel protein similar to mouse tropomodulin 1 (Tmod1) [Source:UniProtKB/TrEMBL;Acc:B0S7F1]
Human Orthologue:
LMOD1
Human Description:
leiomodin 1 (smooth muscle) [Source:HGNC Symbol;Acc:6647]
Mouse Orthologue:
Lmod1
Mouse Description:
leiomodin 1 (smooth muscle) Gene [Source:MGI Symbol;Acc:MGI:2135671]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17930 Nonsense Available for shipment Available now
sa127 Nonsense Available for shipment Available now
sa41229 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078545 Nonsense 141 645 2 3
ENSDART00000131348 Nonsense 141 641 2 2
Genomic Location (Zv9):
Chromosome 8 (position 29155004)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28282922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAAGATAAGGAGAGAACGAGAAAATGGGAGGATGACTCTAAAGATT[T/A]ATCTGATGAGGGAAAGAATAAACGGGAGGAAAAGAGAAMAGGTGATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078545 Nonsense 283 645 2 3
ENSDART00000131348 Nonsense 283 641 2 2
Genomic Location (Zv9):
Chromosome 8 (position 29154579)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28282497
KASP Assay ID:
554-0180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTGAAGAAACAAGTTTGGATAAAACCAGACCTCAAAAGGAGAGAGAA[C/T]AAGTGAAAGCACCAGAAAACAGCAAGGCCAAGATTTTTACCAGTTCTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078545 Nonsense 503 645 2 3
ENSDART00000131348 Nonsense 503 641 2 2
Genomic Location (Zv9):
Chromosome 8 (position 29153919)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28281837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACATGGACAGGAAACGGCAGCAGCGATTAGAAGCGCAAAAACTCGCC[G/T]GACATGAGATCAACTCCACTGCACGTGAAGAAAATAAGAGCTCAACTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link