lmod1

Ensembl ID:
ENSDARG00000056111
ZFIN ID:
ZDB-GENE-081104-348
Description:
Novel protein similar to mouse tropomodulin 1 (Tmod1) [Source:UniProtKB/TrEMBL;Acc:B0S7F1]
Human Orthologue:
LMOD1
Human Description:
leiomodin 1 (smooth muscle) [Source:HGNC Symbol;Acc:6647]
Mouse Orthologue:
Lmod1
Mouse Description:
leiomodin 1 (smooth muscle) Gene [Source:MGI Symbol;Acc:MGI:2135671]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17930 Nonsense Available for shipment Available now
sa127 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078545 Nonsense 141 645 2 3
ENSDART00000131348 Nonsense 141 641 2 2
Genomic Location:
Chromosome 8 (position 29155004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAAGATAAGGAGAGAACGAGAAAATGGGAGGATGACTCTAAAGATT[T/A]ATCTGATGAGGGAAAGAATAAACGGGAGGAAAAGAGAAMAGGTGATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078545 Nonsense 283 645 2 3
ENSDART00000131348 Nonsense 283 641 2 2
Genomic Location:
Chromosome 8 (position 29154579)
KASP Assay ID:
554-0180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTGAAGAAACAAGTTTGGATAAAACCAGACCTCAAAAGGAGAGAGAA[C/T]AAGTGAAAGCACCAGAAAACAGCAAGGCCAAGATTTTTACCAGTTCTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4r3uz2fv