uxs1

Ensembl ID:
ENSDARG00000056102
ZFIN ID:
ZDB-GENE-020419-37
Description:
UDP-glucuronic acid decarboxylase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6GMI9]
Human Orthologue:
UXS1
Human Description:
UDP-glucuronate decarboxylase 1 [Source:HGNC Symbol;Acc:17729]
Mouse Orthologue:
Uxs1
Mouse Description:
UDP-glucuronate decarboxylase 1 Gene [Source:MGI Symbol;Acc:MGI:1915133]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34550 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078525 Essential Splice Site 90 418 5 15
Genomic Location (Zv9):
Chromosome 9 (position 6336273)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6317569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCCACCAGTGAAATTCTTATCCGAGAAGGACCGAAAGAGGATTTTGG[T/A]AAGTTCTTTAACATTCTCAAGGGTCCAAAACAGCTTTTTTTCAACAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078525 Nonsense 155 418 7 15
Genomic Location (Zv9):
Chromosome 9 (position 6349621)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6330917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WYTCACTTTAACTCTTTTTGTTCTCTTCTTTTCTCAGTTGACCAGATATA[T/G]CATTTGGCCTCGCCWGCATCGCCACCRAACTAYATGTACAATCCGATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link