kcnd3

Ensembl ID:
ENSDARG00000056101
ZFIN ID:
ZDB-GENE-030131-5626
Description:
potassium voltage-gated channel subfamily D member 3 [Source:RefSeq peptide;Acc:NP_956096]
Human Orthologue:
KCND3
Human Description:
potassium voltage-gated channel, Shal-related subfamily, member 3 [Source:HGNC Symbol;Acc:6239]
Mouse Orthologue:
Kcnd3
Mouse Description:
potassium voltage-gated channel, Shal-related family, member 3 Gene [Source:MGI Symbol;Acc:MGI:19287

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34425 Nonsense Mutation detected in F1 DNA During 2017
sa44688 Nonsense Mutation detected in F1 DNA During 2017
sa21312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078533 Nonsense 133 638 2 7
ENSDART00000127984 Nonsense 133 650 1 7
Genomic Location (Zv9):
Chromosome 8 (position 28920646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28048564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGCGTTTTTTGGAATCATTCCTGAGATCATCAGCGACTGCTGTTA[T/A]GAAGAGTACAAGGACCGCAAGAGGGAGAACACTGAGCGTCTAATGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078533   None 638 None 7
ENSDART00000127984 Nonsense 465 650 4 7
Genomic Location (Zv9):
Chromosome 8 (position 29077750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTCCCTCCCACTCTTACACAACAGCAGCTCCCCTATTACAAGATG[A/T]AACTTTCACCACAGGTACTGAGCCAAACAACACACACTCCGTCCCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078533 Nonsense 608 638 7 7
ENSDART00000127984 Nonsense 620 650 7 7
Genomic Location (Zv9):
Chromosome 8 (position 29084887)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28212805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTACAACGGCCATCATCAGTATCCCGACTCCTCCCTCAAACAACTCT[C/T]GAGCCAGTCCCGACGCCCCGTCCCCTCCCAACCCAGAAGCCCCACCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link