kcnd3

Ensembl ID:
ENSDARG00000056101
ZFIN ID:
ZDB-GENE-030131-5626
Description:
potassium voltage-gated channel subfamily D member 3 [Source:RefSeq peptide;Acc:NP_956096]
Human Orthologue:
KCND3
Human Description:
potassium voltage-gated channel, Shal-related subfamily, member 3 [Source:HGNC Symbol;Acc:6239]
Mouse Orthologue:
Kcnd3
Mouse Description:
potassium voltage-gated channel, Shal-related family, member 3 Gene [Source:MGI Symbol;Acc:MGI:19287

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34425 Nonsense Mutation detected in F1 DNA During 2017
sa21312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078533 Nonsense 133 638 2 7
ENSDART00000127984 Nonsense 133 650 1 7
Genomic Location (Zv9):
Chromosome 8 (position 28920646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28048564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGCGTTTTTTGGAATCATTCCTGAGATCATCAGCGACTGCTGTTA[T/A]GAAGAGTACAAGGACCGCAAGAGGGAGAACACTGAGCGTCTAATGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078533 Nonsense 608 638 7 7
ENSDART00000127984 Nonsense 620 650 7 7
Genomic Location (Zv9):
Chromosome 8 (position 29084887)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28212805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTACAACGGCCATCATCAGTATCCCGACTCCTCCCTCAAACAACTCT[C/T]GAGCCAGTCCCGACGCCCCGTCCCCTCCCAACCCAGAAGCCCCACCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link