olfcs1

Ensembl ID:
ENSDARG00000056097
ZFIN ID:
ZDB-GENE-050419-111
Description:
pheromone receptor-like [Source:RefSeq peptide;Acc:NP_001038510]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5816 Essential Splice Site F2 line generated During 2014
sa14057 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa5816
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044535 Essential Splice Site 25 860 2 10
ENSDART00000143140 None None 844 None 6
Genomic Location:
Chromosome 7 (position 71387674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTGGCAGTGGATGCCCTTTCACCTTATTCTCATGCCCTTTCTGCCC[G/A]TATTCTCAGCTGGGCAACAATGCTAACCACTGGGCCACCATACAGCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044535 Essential Splice Site 32 860 None 10
ENSDART00000143140 Missense 14 844 1 6
Genomic Location:
Chromosome 7 (position 71387012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTTGGCATGGTCAGGGTTTGTAATGCAAACCCAACCTGTAGTCTAA[A/G]GAAAAGTTTTGTCTCGGAAAGCTTGTATAAAGACGGCGATGTGATTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gtc0wfe5