si:dkey-12h9.6

Ensembl ID:
ENSDARG00000056092
ZFIN ID:
ZDB-GENE-041001-145
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SNQ5]
Human Orthologue:
TMEM57
Human Description:
transmembrane protein 57 [Source:HGNC Symbol;Acc:25572]
Mouse Orthologue:
Tmem57
Mouse Description:
transmembrane protein 57 Gene [Source:MGI Symbol;Acc:MGI:1913396]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23713 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078526 Nonsense 326 654 8 13
ENSDART00000140255   None 273 None 5
ENSDART00000147152   None 213 None 5
Genomic Location (Zv9):
Chromosome 20 (position 26065397)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26136700
KASP Assay ID:
2261-4364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGATCAGAGCAGCAAAGCTCTAAGATCCTCCAAGAGCTCTCTGCCT[A/T]AAGTGCAGCGAAGCTCAGTGAATGTTCCTAATGGCAAAGCCGAGAAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link