cttnbp2nl

Ensembl ID:
ENSDARG00000056091
ZFIN ID:
ZDB-GENE-040724-65
Description:
CTTNBP2 N-terminal-like protein [Source:RefSeq peptide;Acc:NP_001070839]
Human Orthologue:
CTTNBP2NL
Human Description:
CTTNBP2 N-terminal like [Source:HGNC Symbol;Acc:25330]
Mouse Orthologue:
Cttnbp2nl
Mouse Description:
CTTNBP2 N-terminal like Gene [Source:MGI Symbol;Acc:MGI:1933137]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5486 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078528 Nonsense 195 594 6 6
ENSDART00000132632 Nonsense 183 582 6 6
ENSDART00000136562 Nonsense 164 225 5 5

The following transcripts of ENSDARG00000056091 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 28677446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGCGGTCAGTCCTGTCGAGTCAAGCTGTGGAAGATTTAGCAGAGCAA[C/T]AGCAGTTATCCTCAACCCTAGCTAAAGAATGTCAGAAGGCTACAGCCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gayrrnjj