si:dkey-12h9.7

Ensembl ID:
ENSDARG00000056089
ZFIN ID:
ZDB-GENE-041001-146
Description:
nuclear receptor-binding protein [Source:RefSeq peptide;Acc:NP_001038654]
Human Orthologue:
NRBP1
Human Description:
nuclear receptor binding protein 1 [Source:HGNC Symbol;Acc:7993]
Mouse Orthologue:
Nrbp1
Mouse Description:
nuclear receptor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2183436]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25137 Nonsense Mutation detected in F1 DNA During 2017
sa6634 Nonsense Mutation detected in F1 DNA During 2017
sa37037 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29368 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Nonsense 45 535 2 18
ENSDART00000147845 Nonsense 29 519 2 18
Genomic Location (Zv9):
Chromosome 20 (position 26033823)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26105126
KASP Assay ID:
554-7357.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGACAGGGGGTTTCATCGGTGTCTCCACCGGTGTCCACAGTAACA[C/T]AGCCTGCACCGTCTGCTACTGAGGATGAGGAGGAAGAGAGTGAAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Nonsense 92 535 3 18
ENSDART00000147845 Nonsense 76 519 3 18
Genomic Location (Zv9):
Chromosome 20 (position 26035500)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26106803
KASP Assay ID:
554-4332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCCCAACAGGTTAACCAGCGAAATGTCCCAGGTATCGACAATGCTTA[T/A]CTTGCCATGGACACTGAAGAAGGTGTGGAGGTGGTGTGGAATGAGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Essential Splice Site 486 535 16 18
ENSDART00000147845 Essential Splice Site 470 519 16 18
Genomic Location (Zv9):
Chromosome 20 (position 26046808)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26118111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGGAAGATAAGCTGAACCGACACTTGAGTTGTGATTTGGCACCAAG[T/A]GAGTATTTTATCAGGCCTCAAACAAACTCTACACAACTATGTAAACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Essential Splice Site 504 535 17 18
ENSDART00000147845 Essential Splice Site 488 519 17 18
Genomic Location (Zv9):
Chromosome 20 (position 26047766)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26119069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACAGGAGTTGGCTGTGGAACTGGTCCAGCTTGGTTTCATTAGTGAGG[T/C]AAGAAGCTTCATTTAGATGTGCTGAACACAACAATTTTTAAATGTTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link