igsf21b

Ensembl ID:
ENSDARG00000056084
ZFIN ID:
ZDB-GENE-070424-59
Description:
immunoglobin superfamily, member 21b [Source:RefSeq peptide;Acc:NP_001103943]
Human Orthologue:
IGSF21
Human Description:
immunoglobin superfamily, member 21 [Source:HGNC Symbol;Acc:28246]
Mouse Orthologue:
Igsf21
Mouse Description:
immunoglobin superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2681842]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45797 Nonsense Mutation detected in F1 DNA During 2018
sa1517 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104188 Nonsense 42 473 2 10
Genomic Location (Zv9):
Chromosome 23 (position 21939736)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21719043
GRCz11 23 21645594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAGCCTCTGCCTCCTGTGGTTATGGGGGACACTGTGACTTTGAAGTG[C/A]AATTTCAGGACGGATGGCAACTTACGAGAGATTGTGTGGTTTCGGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104188 Essential Splice Site 434 473 8 10
Genomic Location (Zv9):
Chromosome 23 (position 21948120)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21727427
GRCz11 23 21653978
KASP Assay ID:
554-1441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACCCTTTGGGATCCACCAACACACACACCCGCCTCATAGTGTTCG[G/A]TCAGTATACCASATGCATCACATGCACATGCCAATATTCATATCCNNCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link