si:dkey-191g9.5

Ensembl ID:
ENSDARG00000056080
ZFIN ID:
ZDB-GENE-090313-217
Description:
Novel protein similar to vertebrate RAP1, GTP-GDP dissociation stimulator 1 (RAP1GDS1) [Source:UniPr
Human Orthologue:
RAP1GDS1
Human Description:
RAP1, GTP-GDP dissociation stimulator 1 [Source:HGNC Symbol;Acc:9859]
Mouse Orthologue:
Rap1gds1
Mouse Description:
RAP1, GTP-GDP dissociation stimulator 1 Gene [Source:MGI Symbol;Acc:MGI:2385189]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35465 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31921 Nonsense Available for shipment Available now
sa38934 Nonsense Mutation detected in F1 DNA During 2017
sa22277 Nonsense Available for shipment Available now
sa1446 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa35465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Essential Splice Site 80 560 3 14
Genomic Location (Zv9):
Chromosome 13 (position 21871560)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21600898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACTCACCTCTCAGGTCACTTTACTGGTGGCAGAGATGGCCAGAGAAG[G/A]TAAAAACAACTATTATTATTGTTATTATTCATTTATTAATTCATTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 193 560 6 14
Genomic Location (Zv9):
Chromosome 13 (position 21865683)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21595021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCTGAGGTTTTGACCCATCAGCTGAAACGGGCTCCAGATGCAGAA[C/T]GACGGCATCTCATACTAGAGGTTCTTGGTTCACTGGGAGAAAGTGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 258 560 8 14
Genomic Location (Zv9):
Chromosome 13 (position 21863820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21593158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCAGATTATTTGTTTTGAGCTTGATCTGCATTTCATTACAGATGAAT[C/A]AATGCAGAAATGTTTTGGAGAAGGGACGGGGATGGTGTATCAGGATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 271 560 8 14
Genomic Location (Zv9):
Chromosome 13 (position 21863780)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21593118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATGAATCAATGCAGAAATGTTTTGGAGAAGGGACGGGGATGGTGTA[T/A]CAGGATGTTCTCGCTTGGCTGCAGTCATCAAACACTGAGCTGCAGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1446
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Essential Splice Site 519 560 14 14
Genomic Location (Zv9):
Chromosome 13 (position 21852797)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21582135
KASP Assay ID:
554-1372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAAAACTAATTTATAACCTCCTAATTACATTTCTGTTCTCTCCTACA[G/A]CCATACTAAGGGAGCAGATAACATCTCTAAACCTGAGGGACACCCTGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link