rftn2

Ensembl ID:
ENSDARG00000056078
ZFIN ID:
ZDB-GENE-040426-2760
Description:
raftlin-2 [Source:RefSeq peptide;Acc:NP_998585]
Human Orthologue:
RFTN2
Human Description:
raftlin family member 2 [Source:HGNC Symbol;Acc:26402]
Mouse Orthologue:
Rftn2
Mouse Description:
raftlin family member 2 Gene [Source:MGI Symbol;Acc:MGI:1921263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16417 Nonsense Available for shipment Available now
sa16706 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078499 Nonsense 73 437 2 9

The following transcripts of ENSDARG00000056078 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 33361881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTATGTGAGCTGCCTCATGCCCTCCAGTCCTACTACACCCAGGGCTA[C/A]GTACTGGCCGCCTTGCATCCCATCATCCTATCTGTGGGACGGACACGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078499 Nonsense 271 437 5 9

The following transcripts of ENSDARG00000056078 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 33353538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGCTTATTACCGCAAGGGCTGGTCATTGGTTGATTCCTTTGTATACT[G/A]GGATACCCCTAAAGGTACTTCATGCACACATACAGTAGTCACCATTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6q8xtsmi