dcst1

Ensembl ID:
ENSDARG00000056077
ZFIN ID:
ZDB-GENE-070809-5
Human Orthologue:
DCST1
Human Description:
DC-STAMP domain containing 1 [Source:HGNC Symbol;Acc:26539]
Mouse Orthologue:
Dcst1
Mouse Description:
DC-STAMP domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1925022]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078480 Essential Splice Site 310 671 8 16
Genomic Location (Zv9):
Chromosome 16 (position 30951133)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28788271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGATCAACAGGCTTGCAGAACACTTCACCACCAATTTAGTTCTTGAGG[T/G]AAAATGAAAAATATTMAATTTTCAGATAGAAGGCTARTAACCTGATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link