mov10b.2

Ensembl ID:
ENSDARG00000056065
ZFIN ID:
ZDB-GENE-060526-371
Description:
Putative helicase mov-10-B.2 [Source:UniProtKB/Swiss-Prot;Acc:Q1LXK5]
Human Orthologue:
MOV10
Human Description:
Mov10, Moloney leukemia virus 10, homolog (mouse) [Source:HGNC Symbol;Acc:7200]
Mouse Orthologue:
Mov10
Mouse Description:
Moloney leukemia virus 10 Gene [Source:MGI Symbol;Acc:MGI:97054]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7140 Nonsense Mutation detected in F1 DNA During 2014
sa17096 Nonsense Available for shipment Available now
sa5485 Nonsense Mutation detected in F1 DNA During 2014
sa510 Nonsense Available for shipment Available now
sa9008 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078491 Nonsense 32 1015 1 22
Genomic Location:
Chromosome 8 (position 28509532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGACAATTGGATTGGATTTTWTAGAGATGCTGGAGGAAACAAACAGG[A/T]GATCCATTTCGGACAGAAANTACTCTGACAGATATCTACAACACAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078491 Nonsense 77 1015 2 22
Genomic Location:
Chromosome 8 (position 28509310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCGAGTCCTCTATGCGTTGAGAAAYGCCAATAAAGCGCGCCTCTCA[A/T]GAACAGGTCGTGTTTACTTCAATACTAATGTGAGACATTTTATTTCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078491 Nonsense 439 1015 8 22
Genomic Location:
Chromosome 8 (position 28497419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGAGAGGAGATCACCTRCTTCTTACTAAAAGCGAGGAGGTCACTTTTT[C/A]AAATGTGACCAAATAYAAGGGCTACGTCCACAGAGTGGAACTGGATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078491 Nonsense 534 1015 10 22
Genomic Location:
Chromosome 8 (position 28495827)
KASP Assay ID:
554-0229.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTTTTGTCTTTAGGCTCTTTGATCGAAAGCTTGAGTACAACTTTCAA[C/T]AGTACAGTGCAGTGTGTAACATTGTGGCCGGTACTTCCAAACCTGCACCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078491 Nonsense 555 1015 10 22
Genomic Location:
Chromosome 8 (position 28495764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTAACATTGTGGCCGGTACTTCCAAACCTGCACCGTATCTGGTGTTT[G/T]GACCTCCTGGCACTGGTAAAACCGTCACRATAGTGGAGGCTATCAAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n5q2pmn3