rangap1

Ensembl ID:
ENSDARG00000056059
ZFIN ID:
ZDB-GENE-040426-1921
Description:
Ran GTPase activating protein 1 [Source:RefSeq peptide;Acc:NP_998154]
Human Orthologue:
RANGAP1
Human Description:
Ran GTPase activating protein 1 [Source:HGNC Symbol;Acc:9854]
Mouse Orthologue:
Rangap1
Mouse Description:
RAN GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:103071]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35260 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31872 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Essential Splice Site None 576 None 16
ENSDART00000142253   None 237 1 7
Genomic Location:
Chromosome 12 (position 20124267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGAACTGCCGCCTCCATGTGCCTCCTGTTTTGATGGTTTTATTCTGG[T/A]AAGTTAGTTATCTGCTATCTTCCTCCATTAAAATCCGCGCCGAGGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Essential Splice Site 100 576 4 16
ENSDART00000142253 Essential Splice Site 100 237 4 7
Genomic Location:
Chromosome 12 (position 20122772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGACATGTTTACAGGCCGCCTTCGCTCTGAAATTCCACCTGCTCTGG[T/C]AAGCTTTTGTATATCCAGTTAAAAACATTTATTTCTTTTAGGGCTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Nonsense 366 576 11 16
ENSDART00000142253   None 237 None 7
Genomic Location:
Chromosome 12 (position 20111251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGTAATGGGACATGCTTAATGCAGTGATGATGAAGGAGAGCCTGAT[G/T]AAGAGGACAACGACGACNNNNNNNNNNNNNNNGACGANNNNNNTGATGATGAGGAAGAAGATGAAGATGANNNNNNT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link