rangap1

Ensembl ID:
ENSDARG00000056059
ZFIN ID:
ZDB-GENE-040426-1921
Description:
Ran GTPase activating protein 1 [Source:RefSeq peptide;Acc:NP_998154]
Human Orthologue:
RANGAP1
Human Description:
Ran GTPase activating protein 1 [Source:HGNC Symbol;Acc:9854]
Mouse Orthologue:
Rangap1
Mouse Description:
RAN GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:103071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Nonsense 366 576 11 16
ENSDART00000142253 None None 237 None 7
Genomic Location:
Chromosome 12 (position 20111251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGTAATGGGACATGCTTAATGCAGTGATGATGAAGGAGAGCCTGAT[G/T]AAGAGGACAACGACGACNNNNNNNNNNNNNNNGACGANNNNNNTGATGATGAGGAAGAAGATGAAGATGANNNNNNT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/faof3ev1