RYR2 (1 of 3)

Ensembl ID:
ENSDARG00000056058
Description:
ryanodine receptor 2 (cardiac) [Source:HGNC Symbol;Acc:10484]
Human Orthologue:
RYR2
Human Description:
ryanodine receptor 2 (cardiac) [Source:HGNC Symbol;Acc:10484]
Mouse Orthologue:
Ryr2
Mouse Description:
ryanodine receptor 2, cardiac Gene [Source:MGI Symbol;Acc:MGI:99685]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078464 Nonsense 35 164 2 6
Genomic Location (Zv9):
Chromosome 12 (position 48477288)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47357321
KASP Assay ID:
2260-5782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTGCCGGTGGAGGCATCGGGGATCAGATTGAAGATCCAGCCGGAGAC[G/T]AGTACGAGATCTACCGCATCATCTTCGACATCACCTTCTTCTTCTTCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link