noxa1

Ensembl ID:
ENSDARG00000056047
ZFIN ID:
ZDB-GENE-050913-32
Description:
NADPH oxidase activator 1 [Source:RefSeq peptide;Acc:NP_001025271]
Human Orthologue:
NOXA1
Human Description:
NADPH oxidase activator 1 [Source:HGNC Symbol;Acc:10668]
Mouse Orthologue:
Noxa1
Mouse Description:
NADPH oxidase activator 1 Gene [Source:MGI Symbol;Acc:MGI:2449980]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40448 Nonsense Mutation detected in F1 DNA During 2017
sa31445 Nonsense Available for shipment Available now
sa20441 Essential Splice Site Available for shipment Available now
sa12640 Nonsense Available for shipment Available now
sa2232 Nonsense F2 line generated During 2017
sa20440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Nonsense 22 269 2 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30790548)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28551905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATCCGCCTGTGGGATGAGGCCGTAAAGGCAATAGACATTCGGGACTG[G/A]CAGGGAGCTCTCAGTAAACTCAACCAGATCACGGATCATAACTGTCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Nonsense 109 269 4 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30787818)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28549175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGTATTTGGGCTCAGAAATACATGAGGGAAAACCCTGTCATTGACTA[C/A]AAGCAGCTGGGTCTTCGCTATAAACTCTACAGCTGGCAGGTCAGAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Essential Splice Site 168 269 6 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30781731)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28543088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTATCACTGAACATTGTACTCACTTAATGATTCTGTCAATGGCATTTC[A/G]GAGGAAGGATGTTTTGGAGCCTCTTCTGCTTCCTGAGGGTGAAGTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Nonsense 199 269 6 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30781635)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28542992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCGTCCTAGGAAACTTGAGGTGGACCAGCTAAAACCGAGGGACTTCT[T/A]GGGTGAAGCRAAGGTGATTCAWATCTTCACRCTGTATTRCAGTTTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2232
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Nonsense 224 269 6 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30781559)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28542916
KASP Assay ID:
554-2939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACGCTGTATTGCAGTTTTAATGCCTGTTCAAGTGCGGAATTTGAATA[C/A]TGGATAAATATAAATGTTCAAAACCAATTATTACAGACAATATACGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078469 Nonsense 234 269 6 6

The following transcripts of ENSDARG00000056047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30781530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28542887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGTGCGGAATTTGAATACTGGATAAATATAAATGTTCAAAACCAAT[T/A]ATTACAGACAATATACGATAAGAAAGGGAATGCACCAAGTAAAGGGGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link