LOC568219

Ensembl ID:
ENSDARG00000056045
Human Orthologue:
GUCY2C
Human Description:
guanylate cyclase 2C (heat stable enterotoxin receptor) [Source:HGNC Symbol;Acc:4688]
Mouse Orthologue:
Gucy2c
Mouse Description:
guanylate cyclase 2c Gene [Source:MGI Symbol;Acc:MGI:106903]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8811 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35261 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078438 Essential Splice Site 427 1076 10 27
Genomic Location (Zv9):
Chromosome 12 (position 20177421)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18959265
KASP Assay ID:
2260-5275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGCAGTCTCGTCTGCCTAACGACAGTCCATCCAAAGGTCTCTCAGG[T/C]AAAAAGCAATTAAAACACGACTGNNGATTTTATAGGAAATGATTGTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078438 Nonsense 913 1076 23 27
Genomic Location (Zv9):
Chromosome 12 (position 20166814)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18948658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTATGGGCACAATACAGTTGAGCCATCTTCCTGGCATCCCTGTGTG[G/A]ATCCGTATCGGTGTGCATTCAGGTAACATTTATTTTTTTGTACTACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link