LAMA1

Ensembl ID:
ENSDARG00000056043
Description:
laminin, alpha 1 [Source:HGNC Symbol;Acc:6481]
Human Orthologue:
LAMA1
Human Description:
laminin, alpha 1 [Source:HGNC Symbol;Acc:6481]
Mouse Orthologue:
Lama1
Mouse Description:
laminin, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:99892]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4267 Nonsense Mutation detected in F1 DNA During 2014
sa13584 Essential Splice Site Available for shipment Available now
sa17699 Nonsense Available for shipment Available now
sa10397 Nonsense Available for shipment Available now
sa24576 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078414 Nonsense 266 2660 6 67
ENSDART00000108598 Nonsense 266 2680 6 63
Genomic Location:
Chromosome 24 (position 43476033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCTTCTGARTGAATAACTGTATTATGGTCTGTTTTTCAGTATTATTA[C/A]TCCATCAAGGACATCTCAGTGGGCGGGATGTGCATCTGCTATGGCCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078414 Essential Splice Site 293 2660 6 67
ENSDART00000108598 Essential Splice Site 293 2680 6 63
Genomic Location:
Chromosome 24 (position 43476115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTGCTATGGCCACGCCCAGAGCTGCCCCTGGGACCCTGTTACCAAG[G/A]TAACCGTYAACACATTGKAGCTGAAGCTGCCAATCAAACTATAGTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078414 Nonsense 436 2660 10 67
ENSDART00000108598 Nonsense 436 2680 10 63
Genomic Location:
Chromosome 24 (position 43481786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGATGTTGTTTGTGTCGTGCAGGTCTGTCTCCAGGTCAGTGTGTGTG[T/A]AAGGAGGGTTTTGCGGGAGAGAAGTGTGACCGMTGTGCGTTCGGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078414 Nonsense 675 2660 14 67
ENSDART00000108598 Nonsense 675 2680 14 63
Genomic Location:
Chromosome 24 (position 43487513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGACGAGCTGATGACRGTGCTGGCGGACGTTGCTGCGCTCAGGGTT[C/T]GAGCCGAGCTGGARGACAGCGCTGAGGGAACGCTCAGGTCAGACACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078414 Nonsense 1203 2660 27 67
ENSDART00000108598 Nonsense 1203 2680 27 63
Genomic Location:
Chromosome 24 (position 43500489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCTCTCTCCTCACCGGACCGTATTACTGGAGACTCCCACAGAAATA[C/A]AACGGCAACAAGGTACAAATACACAACACACCCACAGAAACACCAGGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s9olj118