tprg1

Ensembl ID:
ENSDARG00000056026
ZFIN ID:
ZDB-GENE-070410-113
Description:
tumor protein p63-regulated gene 1 protein [Source:RefSeq peptide;Acc:NP_001082997]
Human Orthologue:
TPRG1
Human Description:
tumor protein p63 regulated 1 [Source:HGNC Symbol;Acc:24759]
Mouse Orthologue:
Tprg
Mouse Description:
transformation related protein 63 regulated Gene [Source:MGI Symbol;Acc:MGI:1918588]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8836 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078447 Nonsense 278 283 6 6
ENSDART00000146574 Nonsense 219 224 5 5
Genomic Location:
Chromosome 6 (position 28503493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGATGTCTGTYATTGCAAACCAAAACAAGCTGGGCTACTGCTTAGCA[C/T]GAGGCAATATTGGYTTCTGATGAYACTTCRACTTTTCTCATGATTGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uzexaeth