hoxb9a

Ensembl ID:
ENSDARG00000056023
ZFIN ID:
ZDB-GENE-990415-109
Description:
Homeobox protein Hox-B9a [Source:UniProtKB/Swiss-Prot;Acc:Q9PWM2]
Human Orthologue:
HOXB9
Human Description:
homeobox B9 [Source:HGNC Symbol;Acc:5120]
Mouse Orthologue:
Hoxb9
Mouse Description:
homeobox B9 Gene [Source:MGI Symbol;Acc:MGI:96190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14877 Nonsense Available for shipment Available now
sa17045 Essential Splice Site, Missense Available for shipment Available now
sa5198 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 135 253 1 4
ENSDART00000023674 Nonsense 135 249 1 2
Genomic Location:
Chromosome 3 (position 23969146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGGGACATCTCGGGGAACCGCCAAAACTCGTTGGGCAGCACGAGTA[T/G]ATCTTGGAGTCCTCCACAGCACGGGAGATAAATTCTGGTCACAGCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Missense 171 253 2 4
ENSDART00000023674 Essential Splice Site 172 249 None 2
Genomic Location:
Chromosome 3 (position 23969257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAAGRASATATGCGAAGGCAGCGAAGACAAAGAGGGACCGGATCAAAG[T/A]AAGTTATAAACCTAGGAAGTGAACACTCTGTAAAGCGTTTAATGCTGTCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 250 253 4 4
ENSDART00000023674 Nonsense 246 249 2 2
Genomic Location:
Chromosome 3 (position 23971986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATGGTTCCAAAACAGAAGGATGAAAATGAAGAAAATGAATAAGGAC[C/T]AGCCCAAAGAATAACGCAGACTGGTACTAGGCGTTCGAGCCATTTACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6n8chpw7