hoxb9a

Ensembl ID:
ENSDARG00000056023
ZFIN ID:
ZDB-GENE-990415-109
Description:
Homeobox protein Hox-B9a [Source:UniProtKB/Swiss-Prot;Acc:Q9PWM2]
Human Orthologue:
HOXB9
Human Description:
homeobox B9 [Source:HGNC Symbol;Acc:5120]
Mouse Orthologue:
Hoxb9
Mouse Description:
homeobox B9 Gene [Source:MGI Symbol;Acc:MGI:96190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14877 Nonsense Available for shipment Available now
sa17045 Essential Splice Site, Missense Available for shipment Available now
sa31325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 135 253 1 4
ENSDART00000023674 Nonsense 135 249 1 2
Genomic Location (Zv9):
Chromosome 3 (position 23969146)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23547357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGGGACATCTCGGGGAACCGCCAAAACTCGTTGGGCAGCACGAGTA[T/G]ATCTTGGAGTCCTCCACAGCACGGGAGATAAATTCTGGTCACAGCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Missense 171 253 2 4
ENSDART00000023674 Essential Splice Site 172 249 None 2
Genomic Location (Zv9):
Chromosome 3 (position 23969257)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23547468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAAGRASATATGCGAAGGCAGCGAAGACAAAGAGGGACCGGATCAAAG[T/A]AAGTTATAAACCTAGGAAGTGAACACTCTGTAAAGCGTTTAATGCTGTCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 215 253 4 4
ENSDART00000023674 Nonsense 211 249 2 2
Genomic Location (Zv9):
Chromosome 3 (position 23971881)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23550092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGACCTTGGAACTAGAGAAGGAATTTCTGTTCAATATGTACCTCACC[C/T]GAGACCGAAGACACGAGGTTGCTCGTCTACTGAACTTGACGGAGCGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link