
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TTBK1 (1 of 2)
- Ensembl ID:
- ENSDARG00000056019
- Description:
- tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
- Human Orthologue:
- TTBK1
- Human Description:
- tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
- Mouse Orthologue:
- Ttbk1
- Mouse Description:
- tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1130 | Nonsense | F2 line generated | During 2018 |
sa21939 | Nonsense | Available for shipment | Available now |
sa27808 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7291 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1130
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023981 | Nonsense | 281 | 1162 | 8 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31563284)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 30440646 GRCz11 11 30687830 - KASP Assay ID:
- 554-1041.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGTCAGAGTTTAATGTCTTCCTGGAGCATGTTTTAGCCCTTGACTACTA[T/A]ACCAAACCAGACTATCAGGTACCTACAAACTACCTACACATTTAGTATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21939
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023981 | Nonsense | 538 | 1162 | 12 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31581763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 30459125 GRCz11 11 30706309 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGACTTCGACAGCAAAGAGTGGGTGATCATAGACAAGGAAATGGAGCTC[A/T]GAGACTTCCACCACCTTCCAGGAGCCGAACCTACCACTTCCGGCACGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27808
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023981 | Nonsense | 641 | 1162 | 12 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31582072)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 30459434 GRCz11 11 30706618 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTGCCCTCCGGACGGCCCCGGCGGAGAGATGCAGATAACAACGGACCT[C/T]AGAGACAGGTAAGATTATCCTTTCTAGCACGCTCTGACATGCTAATGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7291
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023981 | Essential Splice Site | 658 | 1162 | 15 | 20 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31585125)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 30462487 GRCz11 11 30709671 - KASP Assay ID:
- 554-5367.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGCGATAAAACAATGAGGTCSTCTGTAGCACATCCTGGTGTTGTCTTTA[A/C]TAGTGTTGTCCCAATACTGAGCTTTCAAGCGGAACTKTTTAAGCGGCGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: