TTBK1 (1 of 2)

Ensembl ID:
ENSDARG00000056019
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1130 Nonsense F2 line generated During 2016
sa21939 Nonsense Mutation detected in F1 DNA During 2016
sa27808 Nonsense Mutation detected in F1 DNA During 2016
sa7291 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1130
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 281 1162 8 20
Genomic Location (Zv9):
Chromosome 11 (position 31563284)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30440646
KASP Assay ID:
554-1041.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTCAGAGTTTAATGTCTTCCTGGAGCATGTTTTAGCCCTTGACTACTA[T/A]ACCAAACCAGACTATCAGGTACCTACAAACTACCTACACATTTAGTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 538 1162 12 20
Genomic Location (Zv9):
Chromosome 11 (position 31581763)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30459125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTTCGACAGCAAAGAGTGGGTGATCATAGACAAGGAAATGGAGCTC[A/T]GAGACTTCCACCACCTTCCAGGAGCCGAACCTACCACTTCCGGCACGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 641 1162 12 20
Genomic Location (Zv9):
Chromosome 11 (position 31582072)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30459434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCCCTCCGGACGGCCCCGGCGGAGAGATGCAGATAACAACGGACCT[C/T]AGAGACAGGTAAGATTATCCTTTCTAGCACGCTCTGACATGCTAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Essential Splice Site 658 1162 15 20
Genomic Location (Zv9):
Chromosome 11 (position 31585125)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30462487
KASP Assay ID:
554-5367.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGATAAAACAATGAGGTCSTCTGTAGCACATCCTGGTGTTGTCTTTA[A/C]TAGTGTTGTCCCAATACTGAGCTTTCAAGCGGAACTKTTTAAGCGGCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link