im:6912374

Ensembl ID:
ENSDARG00000056018
ZFIN ID:
ZDB-GENE-040914-57
Human Orthologue:
ITGA6
Human Description:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
Mouse Orthologue:
Itga6
Mouse Description:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28357 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074401 Essential Splice Site 509 845 13 22
Genomic Location (Zv9):
Chromosome 14 (position 43074289)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41173542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACATATATATATATATAGGTGTCCTCAGATTACTTTTTATGTTGTGC[A/T]GGTTACCCAGGTGCAGTGTAACCCCAATGAGAATAGAACACAGGCCGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link