hoxb13a

Ensembl ID:
ENSDARG00000056015
ZFIN ID:
ZDB-GENE-050812-1
Description:
Homeobox protein Hox-B13a [Source:UniProtKB/Swiss-Prot;Acc:Q1ECY2]
Human Orthologue:
HOXB13
Human Description:
homeobox B13 [Source:HGNC Symbol;Acc:5112]
Mouse Orthologue:
Hoxb13
Mouse Description:
homeobox B13 Gene [Source:MGI Symbol;Acc:MGI:107730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33159 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078428 Nonsense 78 303 1 2
ENSDART00000129192 Nonsense 78 307 1 3
Genomic Location (Zv9):
Chromosome 3 (position 23945800)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23524011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCCAGCTATCCCACTGTGGACGTATCGACTTCAAGTTCGGCGGAGT[C/A]GGGAAAGCAGTGCACACCTTGCCCAACAGTTCCACAGGCCTCGTCCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link