dnajc18

Ensembl ID:
ENSDARG00000056005
ZFIN ID:
ZDB-GENE-030131-8019
Description:
dnaJ homolog subfamily C member 18 [Source:RefSeq peptide;Acc:NP_001107060]
Human Orthologue:
DNAJC18
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 18 [Source:HGNC Symbol;Acc:28429]
Mouse Orthologue:
Dnajc18
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 18 Gene [Source:MGI Symbol;Acc:MGI:1923844]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9193 Nonsense Mutation detected in F1 DNA During 2017
sa37341 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101054 Nonsense 179 407 4 8
Genomic Location (Zv9):
Chromosome 21 (position 28991591)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30210835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTYAGCTATAGGCAATGCWTATGCWGTGCTCAGTAACCCAGAGAAAAGG[C/T]AGCAGTATGATGAGTATGGAGACCAGGGCCCTGCCGAAACATCCAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101054 Essential Splice Site 234 407 4 8
Genomic Location (Zv9):
Chromosome 21 (position 28991422)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30210666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCCCGAGGAGCTCTTCAACATTTTCTTCGGTGGCAGGTTTCCCACAG[G/A]TATGACCCTCTATTAAACACTACAGCTAACTAAATGGATCACACGTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link