fryb

Ensembl ID:
ENSDARG00000056001
ZFIN ID:
ZDB-GENE-080215-5
Human Orthologue:
FRY
Human Description:
furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367]
Mouse Orthologue:
Fry
Mouse Description:
furry homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443895]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5830 Nonsense Mutation detected in F1 DNA During 2014
sa24880 Nonsense Mutation detected in F1 DNA During 2014
sa21770 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10244 Nonsense Available for shipment Available now
sa21771 Nonsense Mutation detected in F1 DNA During 2014
sa24881 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7647 Nonsense Mutation detected in F1 DNA During 2014
sa12198 Nonsense Available for shipment Available now
sa13238 Splice Site, Nonsense Available for shipment Available now
sa2573 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5586 Essential Splice Site F2 line generated During 2014
sa12244 Splice Site, Nonsense Available for shipment Available now
sa4379 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 366 2973 11 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 424 3080 12 61
Genomic Location:
Chromosome 10 (position 34949941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGAGTGGCACTTGAATCCCTCTATCGKYTGCTGTGGGTCTACATGATC[C/T]GAATCAAATGTGAAAGCAACACTGCAACACAAAGGTAGTGTACTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 505 2973 15 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 563 3080 16 61
Genomic Location:
Chromosome 10 (position 34952750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCGCTTACAGTATGGATTGTGTATGCTTCAGGTATGGCACTGTATTA[C/A]TCGCAAGTCAGGAAAGCCATGGATAACATCCTGAGGCATCTGGATAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 659 2973 18 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 717 3080 19 61
Genomic Location:
Chromosome 10 (position 34956594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGAGCTGTGTACCCAATCACCTGTTTTTGTATGTTTGTTGAGCTC[A/T]GATGGGATCCCAGAGCAGCGGAAGCTCCAGGCTGGCGCCTGATCGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 819 2973 20 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 891 3080 21 61
Genomic Location:
Chromosome 10 (position 34959031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCCAGAGCATCTACCCAAACACTGTCCTACAGCGCKCAGCTATGCCT[G/A]GCCCTACGCCTTTACTCGCCTACAGCTGCTKATGCCAYTTGTAGACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 884 2973 21 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 956 3080 22 61
Genomic Location:
Chromosome 10 (position 34961169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAAGCCCAGCATCATGAGCCCAGGTCACCTGAGAGCCTCTACACCT[G/T]AAATAATGGCTACCACCCCTGATGGCAGTGTCACGTACGATAACAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 941 2973 23 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 1013 3080 24 61
Genomic Location:
Chromosome 10 (position 34962822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGCTGTTTTTTATTTCATGACTGTTTCTTACATGTGTGTTTAATT[A/C]GGGAGCTGGTGGAAGAACTTCATCCACTAATGAAAGAAGCTCTGGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 946 2973 23 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 1018 3080 24 61
Genomic Location:
Chromosome 10 (position 34962837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTCATGACTGTTTCTTACATGTGTGTTTAATWAGGGAGCTGGTGGAA[G/T]AACTTCATCCACTAATGAAAGAAGCTCTGGAAAGAAGGCCTGAGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 1178 2973 28 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Nonsense 1250 3080 29 61
Genomic Location:
Chromosome 10 (position 34970497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAACTGGGCTGTGGATCGCTGTTTCACTGGATCATACCAGCTYGCTT[C/A]AGGATGTTTCAAAGCTATCGCTACTGTGTGCGGTAGCAGGTAATCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Splice Site, Nonsense 1416 2973 32 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Splice Site, Nonsense 1522 3080 33 61
Genomic Location:
Chromosome 10 (position 34973004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCATTAGCCTGTGCGGAGTCAGCAGCGACACCACACTGCTGCCATA[T/G]GTGAGCCWTACAGACACACTYAGCCCACATTCAATTTATTAGCTCTRTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
Genomic Location:
Chromosome 10 (position 35003261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGCCCTGCCAGGAAAGACGATGGAATTCCATTTCGATATATCTGAGG[T/C]ATATTGTTGCTCAATTGTTCACATTCRTGTGTGACACTGTATTTTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5586
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547 None None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
Genomic Location:
Chromosome 10 (position 35003261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGCCCTGCCAGGAAAGACGATGGAATTCCATTTCGATATATCTGAGG[T/C]ATATTGTTGCTCAATTGTTCACATTCRTGTGTGACACTGTATTTTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Splice Site, Nonsense 2784 2973 60 62
ENSDART00000138547 Splice Site, Nonsense 9 162 2 4
ENSDART00000142881 Splice Site, Nonsense 2891 3080 59 61
Genomic Location:
Chromosome 10 (position 35019150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGATTCCTTTATTGTCATGTGACTAAACTATTCATATCTTCCACAG[C/T]AATTGGAGTTGTGTCAGCGACTATACAAACTTCACTTCCAGCTCCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 2888 2973 61 62
ENSDART00000138547 Essential Splice Site 113 162 3 4
ENSDART00000142881 Essential Splice Site 2995 3080 60 61
Genomic Location:
Chromosome 10 (position 35022875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAAYAACAACGACTTCTCCATGGCMATCCGCTACACTCAAGAGTGCAGG[T/C]GARCTGAGACACCRCTAGAGGGAGACAAAACTCTGTTGAGAGCAGGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y074gqrp