fryb

Ensembl ID:
ENSDARG00000056001
ZFIN ID:
ZDB-GENE-080215-5
Human Orthologue:
FRY
Human Description:
furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367]
Mouse Orthologue:
Fry
Mouse Description:
furry homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443895]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34945 Nonsense Mutation detected in F1 DNA During 2016
sa5830 Nonsense Mutation detected in F1 DNA During 2016
sa24880 Nonsense Mutation detected in F1 DNA During 2016
sa21770 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10244 Nonsense Available for shipment Available now
sa21771 Nonsense Mutation detected in F1 DNA During 2016
sa24881 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41695 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41696 Nonsense Mutation detected in F1 DNA During 2016
sa12198 Nonsense Available for shipment Available now
sa41697 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa13238 Splice Site, Nonsense Available for shipment Available now
sa27638 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31789 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa5586 Essential Splice Site F2 line generated During 2016
sa41698 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12244 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 249 2973 8 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 297 3080 9 61
Genomic Location (Zv9):
Chromosome 10 (position 34945406)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33973264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAAAAACACTTCTACTGTTATGTGTTTATAGGAGTGTGCTCAGTA[T/A]TTCTTGGAGGTGAAAGATAAGGACATTAAACATTCTCTTGCTGGACTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 366 2973 11 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 424 3080 12 61
Genomic Location (Zv9):
Chromosome 10 (position 34949941)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33977799
KASP Assay ID:
554-3890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGAGTGGCACTTGAATCCCTCTATCGKYTGCTGTGGGTCTACATGATC[C/T]GAATCAAATGTGAAAGCAACACTGCAACACAAAGGTAGTGTACTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 505 2973 15 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 563 3080 16 61
Genomic Location (Zv9):
Chromosome 10 (position 34952750)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33980608
KASP Assay ID:
554-7556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCGCTTACAGTATGGATTGTGTATGCTTCAGGTATGGCACTGTATTA[C/A]TCGCAAGTCAGGAAAGCCATGGATAACATCCTGAGGCATCTGGATAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 659 2973 18 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 717 3080 19 61
Genomic Location (Zv9):
Chromosome 10 (position 34956594)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33984452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGAGCTGTGTACCCAATCACCTGTTTTTGTATGTTTGTTGAGCTC[A/T]GATGGGATCCCAGAGCAGCGGAAGCTCCAGGCTGGCGCCTGATCGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 819 2973 20 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 891 3080 21 61
Genomic Location (Zv9):
Chromosome 10 (position 34959031)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33986889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCCAGAGCATCTACCCAAACACTGTCCTACAGCGCKCAGCTATGCCT[G/A]GCCCTACGCCTTTACTCGCCTACAGCTGCTKATGCCAYTTGTAGACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 884 2973 21 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 956 3080 22 61
Genomic Location (Zv9):
Chromosome 10 (position 34961169)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33989027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAAGCCCAGCATCATGAGCCCAGGTCACCTGAGAGCCTCTACACCT[G/T]AAATAATGGCTACCACCCCTGATGGCAGTGTCACGTACGATAACAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 941 2973 23 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 1013 3080 24 61
Genomic Location (Zv9):
Chromosome 10 (position 34962822)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33990680
KASP Assay ID:
554-7733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGCTGTTTTTTATTTCATGACTGTTTCTTACATGTGTGTTTAATT[A/C]GGGAGCTGGTGGAAGAACTTCATCCACTAATGAAAGAAGCTCTGGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 991 2973 24 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 1063 3080 25 61
Genomic Location (Zv9):
Chromosome 10 (position 34963156)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33991014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCGCATCTTTGAGCTTCTTGCTGACTCTGGGGTCATCAGTGACAGG[T/C]GAAGTCATGTAGTCAAATCCTGGGTTTAACTGTTTAATCTGATCTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 1061 2973 26 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 1133 3080 27 61
Genomic Location (Zv9):
Chromosome 10 (position 34965606)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33993464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCTCTGTAGTCCACAACAGGCGGTTATTGTTCCCCCAGCAGAGCT[T/A]GAGGCATCACCTCTTCATTCTCTTCAGCCAGTGGGCCGGTCCCTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Nonsense 1178 2973 28 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 1250 3080 29 61
Genomic Location (Zv9):
Chromosome 10 (position 34970497)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33998355
KASP Assay ID:
2260-3456.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAACTGGGCTGTGGATCGCTGTTTCACTGGATCATACCAGCTYGCTT[C/A]AGGATGTTTCAAAGCTATCGCTACTGTGTGCGGTAGCAGGTAATCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Splice Site None 2973 None 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Nonsense 1473 3080 33 61
Genomic Location (Zv9):
Chromosome 10 (position 34972855)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34000713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAATTTCATCAAACGACTCGGACATCATTTTCTGTATGGTTTCTCTA[C/T]AGTATGGGGATGAAGTCCCTGGTCCTGAGATGGAGAACGCCTGGAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Splice Site, Nonsense 1416 2973 32 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Splice Site, Nonsense 1522 3080 33 61
Genomic Location (Zv9):
Chromosome 10 (position 34973004)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34000862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCATTAGCCTGTGCGGAGTCAGCAGCGACACCACACTGCTGCCATA[T/G]GTGAGCCWTACAGACACACTYAGCCCACATTCAATTTATTAGCTCTRTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 1531 2973 35 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 1637 3080 36 61
Genomic Location (Zv9):
Chromosome 10 (position 34974943)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34002801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCACGTTACAGCAACAGCTCTGGAGGTTCTTACGATGAGGAGAAGAG[T/A]AAGTTCTGTATGATAATTAATTTAGTAGCAGATTATTTTGTGGTTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 1745 2973 None 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Missense 1861 3080 41 61
Genomic Location (Zv9):
Chromosome 10 (position 34985985)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34013843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGTGGTGGTGGTGGTACAGTGCATGGAGTACTGTCCTGTCCTTACTC[A/T]GGGCTTTCGGACCGCTTTGGTGCCATGAAGACATCACTCCGAAGAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5586
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
ENSDART00000044294 Essential Splice Site 2284 2973 47 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 2400 3080 48 61
Genomic Location (Zv9):
Chromosome 10 (position 35003261)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34031119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGCCCTGCCAGGAAAGACGATGGAATTCCATTTCGATATATCTGAGG[T/C]ATATTGTTGCTCAATTGTTCACATTCRTGTGTGACACTGTATTTTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Essential Splice Site 2777 2973 58 62
ENSDART00000138547   None 162 None 4
ENSDART00000142881 Essential Splice Site 2890 3080 58 61
Genomic Location (Zv9):
Chromosome 10 (position 35018110)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34045968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGACGATGGAGTGATAACCTGTCAGCCTGGAGACTCAGAGGAAAAGG[T/A]GAAAACAGCTGTCTGTGTTCACTCGACATTATTTACATTAATCCAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044294 Splice Site, Nonsense 2784 2973 60 62
ENSDART00000138547 Splice Site, Nonsense 9 162 2 4
ENSDART00000142881 Splice Site, Nonsense 2891 3080 59 61
Genomic Location (Zv9):
Chromosome 10 (position 35019150)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34047008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGATTCCTTTATTGTCATGTGACTAAACTATTCATATCTTCCACAG[C/T]AATTGGAGTTGTGTCAGCGACTATACAAACTTCACTTCCAGCTCCTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link