tmem161b

Ensembl ID:
ENSDARG00000055989
ZFIN ID:
ZDB-GENE-040426-2693
Description:
Transmembrane protein 161B [Source:UniProtKB/Swiss-Prot;Acc:Q7SY10]
Human Orthologue:
TMEM161B
Human Description:
transmembrane protein 161B [Source:HGNC Symbol;Acc:28483]
Mouse Orthologue:
Tmem161b
Mouse Description:
transmembrane protein 161B Gene [Source:MGI Symbol;Acc:MGI:1919995]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33701 Essential Splice Site Available for shipment Available now
sa20522 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078401 Essential Splice Site 1 484 1 12
Genomic Location (Zv9):
Chromosome 5 (position 49853374)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47419072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTGTCAGCCGGCGTTGAGATCTTTCACAGCACTGCTACATCAAAATG[G/T]TAAGAGAAGAGCTGATTATCGGTGCTGTCATGTTTACAGTCATATAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078401 Essential Splice Site 65 484 3 12
Genomic Location (Zv9):
Chromosome 5 (position 49833278)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47398976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCTGGCTGGAAAGCAGCAGAAAGGTGGCAAGAGCAAAAAGGACAGG[T/C]ACAACACTGCATTTCTCCAGATTGCTCGCACTTGTTTGAAGAACATTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link