tmem161b

Ensembl ID:
ENSDARG00000055989
ZFIN ID:
ZDB-GENE-040426-2693
Description:
Transmembrane protein 161B [Source:UniProtKB/Swiss-Prot;Acc:Q7SY10]
Human Orthologue:
TMEM161B
Human Description:
transmembrane protein 161B [Source:HGNC Symbol;Acc:28483]
Mouse Orthologue:
Tmem161b
Mouse Description:
transmembrane protein 161B Gene [Source:MGI Symbol;Acc:MGI:1919995]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33701 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20522 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078401 Essential Splice Site 1 484 1 12
Genomic Location (Zv9):
Chromosome 5 (position 49853374)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47419072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTGTCAGCCGGCGTTGAGATCTTTCACAGCACTGCTACATCAAAATG[G/T]TAAGAGAAGAGCTGATTATCGGTGCTGTCATGTTTACAGTCATATAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078401 Essential Splice Site 65 484 3 12
Genomic Location (Zv9):
Chromosome 5 (position 49833278)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47398976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCTGGCTGGAAAGCAGCAGAAAGGTGGCAAGAGCAAAAAGGACAGG[T/C]ACAACACTGCATTTCTCCAGATTGCTCGCACTTGTTTGAAGAACATTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link