cflar

Ensembl ID:
ENSDARG00000055966
ZFIN IDs:
ZDB-GENE-030826-3, ZDB-GENE-030826-3
Description:
CASP8 and FADD-like apoptosis regulator [Source:RefSeq peptide;Acc:NP_919380]
Human Orthologue:
CFLAR
Human Description:
CASP8 and FADD-like apoptosis regulator [Source:HGNC Symbol;Acc:1876]
Mouse Orthologue:
Cflar
Mouse Description:
CASP8 and FADD-like apoptosis regulator Gene [Source:MGI Symbol;Acc:MGI:1336166]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2599 Nonsense Available for shipment Available now
sa27805 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11641 Nonsense Available for shipment Available now
sa41869 Nonsense Mutation detected in F1 DNA During 2016
sa27804 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 54 461 3 11
ENSDART00000108494 Nonsense 54 418 1 9
Genomic Location (Zv9):
Chromosome 11 (position 31215340)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30092702
KASP Assay ID:
554-2867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGAACTGAGAGGAGATTTGCTGGCCTTTGCCCAACAGAACCCCAAT[C/T]AAGCAGGTCAACCTCATTCTGGAAATGCTCTGCTGATGGAGCTCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Essential Splice Site 218 461 7 11
ENSDART00000108494 Essential Splice Site 218 418 5 9
Genomic Location (Zv9):
Chromosome 11 (position 31214212)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30091574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCCTTTTGAAAAGCAAGTGAGACAATCACAGTGCTTCAATCATGG[T/G]GAGTTAATATGTAGGTATGTACAGTATGTGTAAAGCGGGTGTAAAGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 222 461 8 11
ENSDART00000108494 Nonsense 222 418 6 9
Genomic Location (Zv9):
Chromosome 11 (position 31213815)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30091177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCACTTTATTTTTGACCCTGTGATCTTCTNNNAGAGTTCAACAAAT[T/A]GAAGCTTTCTGTGCCTGAAACAGGGATTCACTATCAACAGGTAAGWTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 251 461 9 11
ENSDART00000108494 Nonsense 251 418 7 9
Genomic Location (Zv9):
Chromosome 11 (position 31213637)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30090999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGCTATTACAGAGGAGTATCAAATGAATCCCGAACAAAGAGGCCTGTG[T/A]GTGATTATTGACTGTGTTGGCTATGATGGAGGTAAGTGTGTGTCATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Essential Splice Site 262 461 9 11
ENSDART00000108494 Essential Splice Site 262 418 7 9
Genomic Location (Zv9):
Chromosome 11 (position 31213604)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30090966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAAAGAGGCCTGTGTGTGATTATTGACTGTGTTGGCTATGATGGAGG[T/C]AAGTGTGTGTCATACTCTCAAAATAAAGGTACGAAAGCTGTCACTGGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link