cflar

Ensembl ID:
ENSDARG00000055966
ZFIN IDs:
ZDB-GENE-030826-3, ZDB-GENE-030826-3
Description:
CASP8 and FADD-like apoptosis regulator [Source:RefSeq peptide;Acc:NP_919380]
Human Orthologue:
CFLAR
Human Description:
CASP8 and FADD-like apoptosis regulator [Source:HGNC Symbol;Acc:1876]
Mouse Orthologue:
Cflar
Mouse Description:
CASP8 and FADD-like apoptosis regulator Gene [Source:MGI Symbol;Acc:MGI:1336166]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2599 Nonsense Available for shipment Available now
sa11641 Nonsense Available for shipment Available now
sa3803 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 54 461 3 11
ENSDART00000108494 Nonsense 54 418 1 9
Genomic Location:
Chromosome 11 (position 31215340)
KASP Assay ID:
554-2867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGAACTGAGAGGAGATTTGCTGGCCTTTGCCCAACAGAACCCCAAT[C/T]AAGCAGGTCAACCTCATTCTGGAAATGCTCTGCTGATGGAGCTCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 222 461 8 11
ENSDART00000108494 Nonsense 222 418 6 9
Genomic Location:
Chromosome 11 (position 31213815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCACTTTATTTTTGACCCTGTGATCTTCTNNNAGAGTTCAACAAAT[T/A]GAAGCTTTCTGTGCCTGAAACAGGGATTCACTATCAACAGGTAAGWTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078378 Nonsense 262 461 9 11
ENSDART00000108494 Nonsense 262 418 7 9
Genomic Location:
Chromosome 11 (position 31213606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAACAAAGAGGCCTGTGTGTGATTATTGACTGTGTTGGCTATGATGGA[G/T]GTAAGTGTGTGTCATACTCTSAAAATAAAGGTACGAAAGCTGTCACTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xmbii8ii