klc3

Ensembl ID:
ENSDARG00000055965
ZFIN ID:
ZDB-GENE-060929-772
Description:
kinesin light chain 3 [Source:RefSeq peptide;Acc:NP_001070646]
Human Orthologue:
KLC3
Human Description:
kinesin light chain 3 [Source:HGNC Symbol;Acc:20717]
Mouse Orthologue:
Klc3
Mouse Description:
kinesin light chain 3 Gene [Source:MGI Symbol;Acc:MGI:1277971]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35884 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35885 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078336 Essential Splice Site None 512 2 14
Genomic Location (Zv9):
Chromosome 15 (position 23012971)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23724158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTATGTTTTCTTTCTTTGCAGCTTTGCATCTTTACTGTGAATTAAG[G/T]TCAGTTTTCAATATTCCATGCTGTTTGTGATGTAAAGTTACGTGTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078336 Essential Splice Site 69 512 3 14
Genomic Location (Zv9):
Chromosome 15 (position 23016406)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23727593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTCTAGAGTCTCTGGAGAGGATCGAGCTGGGCTTAGGAGAGGCGCAA[G/A]TGAGCAGTACACTCATCTTTATTCACATTAAAACAGTCCTTCTAAAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link