olfcd2

Ensembl ID:
ENSDARG00000055949
ZFIN ID:
ZDB-GENE-050712-5
Description:
olfactory receptor C family, d2 [Source:RefSeq peptide;Acc:NP_001074079]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38156 Nonsense Mutation detected in F1 DNA During 2017
sa30347 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38157 Nonsense Available for shipment Available now
sa30348 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099219 Nonsense 509 850 4 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3499 (position 30663)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33080233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACGTCTACAAGTCAATCAGGAAATCATGCTGTGGGCAGGGAAAAGT[G/T]GATTGGTACATCAATATTATAATTTTTCCATGAAGGCATCCGGCAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099219 Essential Splice Site 510 850 4 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3499 (position 30669)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33080239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTACAAGTCAATCAGGAAATCATGCTGTGGGCAGGGAAAAGTGGATTG[G/A]TACATCAATATTATAATTTTTCCATGAAGGCATCCGGCAAATTTGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099219 Nonsense 535 850 5 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3499 (position 30826)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33080396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTCTCCCAGGAACTAGAAAGGCTGTACAAAAAGGACGCCCTGTCTG[C/A]TGTTATGACTGTATTCCATGTGCAGAGGGAGAAATCAGTAACAGCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099219 Essential Splice Site 552 850 5 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3499 (position 30877)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33080447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATGACTGTATTCCATGTGCAGAGGGAGAAATCAGTAACAGCACAGG[T/C]AAAATTATACAAGTGAAATAACTGTGATAAAAGTATTATAAAGTATGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link