tspan14

Ensembl ID:
ENSDARG00000055938
ZFIN ID:
ZDB-GENE-060825-329
Description:
tetraspanin-14 [Source:RefSeq peptide;Acc:NP_001038877]
Human Orthologue:
TSPAN14
Human Description:
tetraspanin 14 [Source:HGNC Symbol;Acc:23303]
Mouse Orthologue:
Tspan14
Mouse Description:
tetraspanin 14 Gene [Source:MGI Symbol;Acc:MGI:1196325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12478 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078352 Essential Splice Site 211 271 7 9
ENSDART00000102227 Essential Splice Site 211 271 6 8
Genomic Location:
Chromosome 13 (position 21783652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTCAACACGCAGTGCGGGTATGATGTTAGAGAAAAAGGCACTTTGG[T/G]AAGTGCATTTTCAACAATTCTAATTTTAGTCTGTGCTTTGCCATTGTTKA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o5jvhbj9