si:ch1073-416j23.1

Ensembl ID:
ENSDARG00000055934
ZFIN ID:
ZDB-GENE-100922-35
Description:
LOC553480 protein [Source:UniProtKB/TrEMBL;Acc:Q501Z7]
Human Orthologue:
RACGAP1
Human Description:
Rac GTPase activating protein 1 [Source:HGNC Symbol;Acc:9804]
Mouse Orthologue:
Racgap1
Mouse Description:
Rac GTPase-activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1349423]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41362 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078348 Nonsense 274 650 8 16
ENSDART00000134911 Nonsense 266 548 8 13
Genomic Location (Zv9):
Chromosome 9 (position 11018655)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10822322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGACACATTCTAACCTTCCCAAACTAAGCGGAGTCCTGCGTGCAGAA[C/T]AAACATCTGTGTGGGCTCACAGTGAAGTCATCCAGGCTGAGACGATGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link