foxi3a

Ensembl ID:
ENSDARG00000055926
ZFIN ID:
ZDB-GENE-031126-3
Description:
forkhead box I3a [Source:RefSeq peptide;Acc:NP_944599]
Human Orthologue:
FOXI1
Human Description:
forkhead box I1 [Source:HGNC Symbol;Acc:3815]
Mouse Orthologue:
Foxi1
Mouse Description:
forkhead box I1 Gene [Source:MGI Symbol;Acc:MGI:1096329]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29622 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29623 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078341 Essential Splice Site 184 353 1 2
Genomic Location (Zv9):
Chromosome 21 (position 29095952)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30315196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTCAATGACTGCTTCATGAAAGTGCCCAGAGATGACAGCGATCCAG[G/A]TGAGAACTTGTTCAAACTGTTCGTGTGTATCTGCTTGGGTTGTACTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078341 Nonsense 216 353 2 2
Genomic Location (Zv9):
Chromosome 21 (position 29096148)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30315392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGATAATGGAAACTTCCGGCGCAAGAGGAAGAGAAAGTCGGACTCT[C/T]AGGCTGAAGAGGAGGGAAAAGGGTACTCTGGATCAGACTCTGCTCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link