luc7l

Ensembl ID:
ENSDARG00000055903
ZFIN ID:
ZDB-GENE-040625-111
Description:
LUC7-like [Source:RefSeq peptide;Acc:NP_001002116]
Human Orthologue:
LUC7L
Human Description:
LUC7-like (S. cerevisiae) [Source:HGNC Symbol;Acc:6723]
Mouse Orthologue:
Luc7l
Mouse Description:
Luc7 homolog (S. cerevisiae)-like Gene [Source:MGI Symbol;Acc:MGI:1914228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24561 Missense, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045273 Missense 330 350 9 10
ENSDART00000078313 Missense 344 364 10 10
ENSDART00000137218 None None 44 None 5
ENSDART00000142182 Nonsense 331 333 9 10

The following transcripts of ENSDARG00000055903 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 41226475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGTGATCGCGAGAGGGACACCAAGCGCAGCTCATCCGAGCGGAGAT[C/T]AGACGGGCTGAACGGCCGGACAGAATCTCGTCGCCATGACGACAGAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lg5hgv3a