dmc1

Ensembl ID:
ENSDARG00000055883
ZFIN ID:
ZDB-GENE-060331-93
Description:
meiotic recombination protein DMC1/LIM15 homolog [Source:RefSeq peptide;Acc:NP_001018618]
Human Orthologue:
DMC1
Human Description:
DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) [Source:HG
Mouse Orthologue:
Dmc1
Mouse Description:
DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) Gene [Sour

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35265 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35266 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078284 Essential Splice Site 128 342 6 14
ENSDART00000078284 Essential Splice Site 128 342 6 14
Genomic Location (Zv9):
Chromosome 12 (position 20454796)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19236640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTTGGAGGAGGTGTGGAGAGTATGGCCATCACCGAGGCTTTTGGTG[G/A]TAGGGTGATGTTTTGATTTGAAACCATAATGATATGTTACGCATTTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078284 Essential Splice Site 128 342 6 14
ENSDART00000078284 Essential Splice Site 128 342 6 14
Genomic Location (Zv9):
Chromosome 12 (position 20454796)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19236640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTTGGAGGAGGTGTGGAGAGTATGGCCATCACCGAGGCTTTTGGTG[G/A]TAGGGTGATGTTTTGATTTGAAACCATAATGATATGTTACGCATTTTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link